Review



guide rna expression plasmid lenti crispr v2  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 96
      Buy from Supplier

    Structured Review

    Addgene inc guide rna expression plasmid lenti crispr v2
    Guide Rna Expression Plasmid Lenti Crispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 6143 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid+lenti+crispr+v2/lentiCRISPR+v2+(Plasmid+%2352961)/pmc12456019-240-28-33
    Average 96 stars, based on 6143 article reviews
    guide rna expression plasmid lenti crispr v2 - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Heat shock protein A1L restricts influenza A virus by ubiquitination of NA
    Article Snippet: .. The HSPA1L gene target sequence (5′- AATCGCCATAGGCATCGACC -3′), NBR1 gene target sequence (5′- CTGATCCAGAAAATACAACT -3′), and TAX1BP1 gene target sequence (5′- TTACCTTCCTAATGCACACC -3′) were separately cloned into the guide RNA expression plasmid Lenti-CRISPR-V2 (Addgene, 52961, depositing lab: Feng Zhang from Broad Institute). .. The resultant recombinant lentiviral plasmids, along with psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) packaging plasmids, were co-transfected into HEK293KT cells using Polyethylenimine HCl MAX, Linear (P4000, LABLEAD) for 48 h. After centrifugation at 10,000 × g for 10 min at 4°C, the supernatants were added to HEK293T cells.

    Clone Assay:

    Article Title: Heat shock protein A1L restricts influenza A virus by ubiquitination of NA
    Article Snippet: .. The HSPA1L gene target sequence (5′- AATCGCCATAGGCATCGACC -3′), NBR1 gene target sequence (5′- CTGATCCAGAAAATACAACT -3′), and TAX1BP1 gene target sequence (5′- TTACCTTCCTAATGCACACC -3′) were separately cloned into the guide RNA expression plasmid Lenti-CRISPR-V2 (Addgene, 52961, depositing lab: Feng Zhang from Broad Institute). .. The resultant recombinant lentiviral plasmids, along with psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) packaging plasmids, were co-transfected into HEK293KT cells using Polyethylenimine HCl MAX, Linear (P4000, LABLEAD) for 48 h. After centrifugation at 10,000 × g for 10 min at 4°C, the supernatants were added to HEK293T cells.

    RNA Expression:

    Article Title: Heat shock protein A1L restricts influenza A virus by ubiquitination of NA
    Article Snippet: .. The HSPA1L gene target sequence (5′- AATCGCCATAGGCATCGACC -3′), NBR1 gene target sequence (5′- CTGATCCAGAAAATACAACT -3′), and TAX1BP1 gene target sequence (5′- TTACCTTCCTAATGCACACC -3′) were separately cloned into the guide RNA expression plasmid Lenti-CRISPR-V2 (Addgene, 52961, depositing lab: Feng Zhang from Broad Institute). .. The resultant recombinant lentiviral plasmids, along with psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) packaging plasmids, were co-transfected into HEK293KT cells using Polyethylenimine HCl MAX, Linear (P4000, LABLEAD) for 48 h. After centrifugation at 10,000 × g for 10 min at 4°C, the supernatants were added to HEK293T cells.

    Plasmid Preparation:

    Article Title: Heat shock protein A1L restricts influenza A virus by ubiquitination of NA
    Article Snippet: .. The HSPA1L gene target sequence (5′- AATCGCCATAGGCATCGACC -3′), NBR1 gene target sequence (5′- CTGATCCAGAAAATACAACT -3′), and TAX1BP1 gene target sequence (5′- TTACCTTCCTAATGCACACC -3′) were separately cloned into the guide RNA expression plasmid Lenti-CRISPR-V2 (Addgene, 52961, depositing lab: Feng Zhang from Broad Institute). .. The resultant recombinant lentiviral plasmids, along with psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259) packaging plasmids, were co-transfected into HEK293KT cells using Polyethylenimine HCl MAX, Linear (P4000, LABLEAD) for 48 h. After centrifugation at 10,000 × g for 10 min at 4°C, the supernatants were added to HEK293T cells.



    Similar Products

    guide rna expression plasmid lenti crispr v2  (Addgene inc)
    96
    Addgene inc guide rna expression plasmid lenti crispr v2
    Guide Rna Expression Plasmid Lenti Crispr V2, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid+lenti+crispr+v2/lentiCRISPR+v2+(Plasmid+%2352961)/pmc12456019-240-28-33
    Average 96 stars, based on 1 article reviews
    guide rna expression plasmid lenti crispr v2 - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier
    chimeric guide rna expression plasmid lenti crispr v2 vector  (Addgene inc)
    96
    Addgene inc chimeric guide rna expression plasmid lenti crispr v2 vector

    Chimeric Guide Rna Expression Plasmid Lenti Crispr V2 Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/guide+rna+expression+plasmid+lenti+crispr+v2/lentiCRISPR+v2+(Plasmid+%2352961)/pmc11742321-370-2-10
    Average 96 stars, based on 1 article reviews
    chimeric guide rna expression plasmid lenti crispr v2 vector - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results


    Journal: iScience

    Article Title: Targeting ROR2 homooligomerization disrupts ROR2-dependent signaling and suppresses stem-like cell properties of human breast adenocarcinoma

    doi: 10.1016/j.isci.2024.111589

    Figure Lengend Snippet:

    Article Snippet: SpCas9 and chimeric guide RNA expression plasmid lenti-CRISPR v2 vector (Addgene) were used to generate stable ROR2 knockout cell-lines.

    Techniques: Virus, Formalin-fixed Paraffin-Embedded, Recombinant, Mutagenesis, Cloning, Activation Assay, Gene Expression, Sequencing, Plasmid Preparation, Software, Imaging